ID: 1084159785_1084159789

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084159785 1084159789
Species Human (GRCh38) Human (GRCh38)
Location 11:67340899-67340921 11:67340935-67340957
Sequence CCACTGCACCTGGCCATGGCCAA ACAGTGCCAACGTAATTAAGTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 47, 3: 391, 4: 2128} {0: 1, 1: 0, 2: 1, 3: 10, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!