ID: 1084166856_1084166867

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1084166856 1084166867
Species Human (GRCh38) Human (GRCh38)
Location 11:67379154-67379176 11:67379198-67379220
Sequence CCTTTCCACTGCCTCGTGTGCAC GGCACCACTGGGGCCCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160} {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!