ID: 1084172031_1084172040

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1084172031 1084172040
Species Human (GRCh38) Human (GRCh38)
Location 11:67405454-67405476 11:67405491-67405513
Sequence CCCTGTTGTGTGGGGCCCATGTG CCCTGGCACCTATCAGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170} {0: 1, 1: 0, 2: 0, 3: 16, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!