ID: 1084182561_1084182573

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1084182561 1084182573
Species Human (GRCh38) Human (GRCh38)
Location 11:67454197-67454219 11:67454224-67454246
Sequence CCAAGAGGCCTGCAGCCCCACCT CTTCCCCGCTGGCAGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 431} {0: 1, 1: 0, 2: 1, 3: 6, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!