ID: 1084195830_1084195841

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1084195830 1084195841
Species Human (GRCh38) Human (GRCh38)
Location 11:67523292-67523314 11:67523329-67523351
Sequence CCCCGGCGCCAGGGCCGCTTGGC GCCCTGAACCATGCCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183} {0: 1, 1: 0, 2: 6, 3: 38, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!