ID: 1084204398_1084204405

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084204398 1084204405
Species Human (GRCh38) Human (GRCh38)
Location 11:67583655-67583677 11:67583671-67583693
Sequence CCCCTCTGCGGCCGACGCCCGGG GCCCGGGGTGCAGCGGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108} {0: 1, 1: 0, 2: 6, 3: 27, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!