ID: 1084204468_1084204475

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1084204468 1084204475
Species Human (GRCh38) Human (GRCh38)
Location 11:67583890-67583912 11:67583909-67583931
Sequence CCAGCATGGGGCCAACCCGCAGC CAGCATCAGGCCCGGGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114} {0: 1, 1: 0, 2: 3, 3: 28, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!