ID: 1084219164_1084219170

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1084219164 1084219170
Species Human (GRCh38) Human (GRCh38)
Location 11:67667049-67667071 11:67667066-67667088
Sequence CCCAGACCTGGGCCAGGAGGGGT AGGGGTCTAGAATTTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 352} {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!