ID: 1084227710_1084227714

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084227710 1084227714
Species Human (GRCh38) Human (GRCh38)
Location 11:67727647-67727669 11:67727662-67727684
Sequence CCCCCGGAGTTCAATAGGCCCTT AGGCCCTTTTCTTTCTATCATGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 28, 3: 19, 4: 61} {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!