ID: 1084258115_1084258119

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1084258115 1084258119
Species Human (GRCh38) Human (GRCh38)
Location 11:67956082-67956104 11:67956101-67956123
Sequence CCTTGTCTTTGCTCTTACCCTGT CTGTGTCTTGCATGATTTGGAGG
Strand - +
Off-target summary No data {0: 7, 1: 11, 2: 8, 3: 20, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!