ID: 1084263129_1084263140

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1084263129 1084263140
Species Human (GRCh38) Human (GRCh38)
Location 11:67991479-67991501 11:67991510-67991532
Sequence CCGACCTCAGACGTGGTAAACTG GAGGAGGGAGGCTGAGTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 1, 3: 3, 4: 65} {0: 6, 1: 1, 2: 1, 3: 64, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!