ID: 1084265839_1084265847

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1084265839 1084265847
Species Human (GRCh38) Human (GRCh38)
Location 11:68004689-68004711 11:68004721-68004743
Sequence CCACAACCATGTAGTGGGGCCCA GCCCCCATCCTGCTGGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} {0: 1, 1: 0, 2: 3, 3: 40, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!