ID: 1084267859_1084267864

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084267859 1084267864
Species Human (GRCh38) Human (GRCh38)
Location 11:68014183-68014205 11:68014198-68014220
Sequence CCTCCCAGTCTAATGAGGGGGAA AGGGGGAAATAAGGGAGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113} {0: 1, 1: 0, 2: 5, 3: 66, 4: 707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!