ID: 1084273031_1084273039

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1084273031 1084273039
Species Human (GRCh38) Human (GRCh38)
Location 11:68039085-68039107 11:68039116-68039138
Sequence CCAGCAGCGGAGGCGCGGCGCGC CGGGGTGAGTGCCCCTGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173} {0: 1, 1: 0, 2: 2, 3: 13, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!