ID: 1084279685_1084279692

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1084279685 1084279692
Species Human (GRCh38) Human (GRCh38)
Location 11:68079846-68079868 11:68079877-68079899
Sequence CCCTTTGGCCTATAGATCAGGTG AGACAGGACAACATGAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103} {0: 1, 1: 0, 2: 1, 3: 38, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!