ID: 1084280382_1084280385

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1084280382 1084280385
Species Human (GRCh38) Human (GRCh38)
Location 11:68086513-68086535 11:68086533-68086555
Sequence CCAGTACTTAATGAAAGACTTCT TCTCTAATACTGAGGGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 172} {0: 1, 1: 0, 2: 1, 3: 18, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!