ID: 1084284046_1084284060

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1084284046 1084284060
Species Human (GRCh38) Human (GRCh38)
Location 11:68120631-68120653 11:68120664-68120686
Sequence CCCGCTTCCCTTGGATTACCCAG AGGAGGGCTTTCGCCGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146} {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!