ID: 1084303411_1084303422

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1084303411 1084303422
Species Human (GRCh38) Human (GRCh38)
Location 11:68265898-68265920 11:68265944-68265966
Sequence CCCAGCTGCATAGCTGTAGGCAG GAGCTGCCCATTGGTCACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133} {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!