ID: 1084314586_1084314595

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084314586 1084314595
Species Human (GRCh38) Human (GRCh38)
Location 11:68337743-68337765 11:68337778-68337800
Sequence CCACCCACAGCCAGATCTTCCTC TGCCTGGTCCACCAACAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 523} {0: 1, 1: 0, 2: 3, 3: 31, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!