ID: 1084318383_1084318393

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084318383 1084318393
Species Human (GRCh38) Human (GRCh38)
Location 11:68359093-68359115 11:68359146-68359168
Sequence CCACAACTTAACAGCCTGAAACA GTGATGAGGAGTGGATTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 362} {0: 1, 1: 0, 2: 2, 3: 7, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!