ID: 1084322293_1084322298

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1084322293 1084322298
Species Human (GRCh38) Human (GRCh38)
Location 11:68380319-68380341 11:68380347-68380369
Sequence CCATAAATGAAGTTTTGTTTGCT CTGTGTTGACTGAGGCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 403} {0: 1, 1: 0, 2: 5, 3: 33, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!