ID: 1084333010_1084333024

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1084333010 1084333024
Species Human (GRCh38) Human (GRCh38)
Location 11:68440654-68440676 11:68440690-68440712
Sequence CCAGCCCCCTTCTGCTTCCTCTG GAGCCCCACCTTGCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 1279} {0: 1, 1: 0, 2: 1, 3: 33, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!