ID: 1084343719_1084343723

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1084343719 1084343723
Species Human (GRCh38) Human (GRCh38)
Location 11:68528368-68528390 11:68528413-68528435
Sequence CCCTCTTCTCTAAAGAAATATAT TTTGATTTAATTTGTGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 771} {0: 1, 1: 5, 2: 66, 3: 752, 4: 4559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!