ID: 1084343719_1084343727

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1084343719 1084343727
Species Human (GRCh38) Human (GRCh38)
Location 11:68528368-68528390 11:68528417-68528439
Sequence CCCTCTTCTCTAAAGAAATATAT ATTTAATTTGTGTGTGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 771} {0: 1, 1: 1, 2: 13, 3: 162, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!