ID: 1084351254_1084351258

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1084351254 1084351258
Species Human (GRCh38) Human (GRCh38)
Location 11:68601442-68601464 11:68601459-68601481
Sequence CCAGTCTCTCCCAGGCAGTGTGG GTGTGGCTGAAAATAAGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 372} {0: 1, 1: 0, 2: 0, 3: 24, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!