ID: 1084375427_1084375437

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084375427 1084375437
Species Human (GRCh38) Human (GRCh38)
Location 11:68773596-68773618 11:68773643-68773665
Sequence CCCTGACCCCGGAGGAGCAGCTG TGACATGAGCAGGCCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 262} {0: 1, 1: 4, 2: 91, 3: 287, 4: 735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!