ID: 1084377953_1084377954

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1084377953 1084377954
Species Human (GRCh38) Human (GRCh38)
Location 11:68791303-68791325 11:68791317-68791339
Sequence CCTGGTCAGTGAAGGGGCAACTG GGGCAACTGCCCCTCCAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 151} {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!