ID: 1084403171_1084403179

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1084403171 1084403179
Species Human (GRCh38) Human (GRCh38)
Location 11:68956441-68956463 11:68956462-68956484
Sequence CCACCTTCCCCTCCTCTATGTCT CTGCTTAAAGAAGAATTTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 174, 4: 1524} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!