ID: 1084455668_1084455677 |
View in Genome Browser |
Spacer: 26 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1084455668 | 1084455677 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:69266823-69266845 | 11:69266872-69266894 |
| Sequence | CCTGGTGCAGAGAAAGCATTTAA | TAACTGGTCCGTGGCCTGTTAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 8, 2: 88, 3: 522, 4: 889} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||