ID: 1084461027_1084461031

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084461027 1084461031
Species Human (GRCh38) Human (GRCh38)
Location 11:69296677-69296699 11:69296692-69296714
Sequence CCCAGCTCCTTCTGGTCATTTTC TCATTTTCTCAGCTGGTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 325} {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!