ID: 1084467587_1084467597

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1084467587 1084467597
Species Human (GRCh38) Human (GRCh38)
Location 11:69335258-69335280 11:69335291-69335313
Sequence CCTGTGCCCAGGGATGCCTTGAT GAGCCTCGGTGGACACACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179} {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!