ID: 1084480252_1084480265

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1084480252 1084480265
Species Human (GRCh38) Human (GRCh38)
Location 11:69415904-69415926 11:69415948-69415970
Sequence CCCTCCTAGGCTGAGCTGAGCCC GGTCCCTGAGGTCCCATAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 260} {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!