ID: 1084484056_1084484068

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1084484056 1084484068
Species Human (GRCh38) Human (GRCh38)
Location 11:69437885-69437907 11:69437929-69437951
Sequence CCCTCAGGGTGGGTCTGGGGGGC TGAAGACAAGGGGCCAACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!