ID: 1084519261_1084519268

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1084519261 1084519268
Species Human (GRCh38) Human (GRCh38)
Location 11:69653595-69653617 11:69653625-69653647
Sequence CCGGCCCCGAGGCCGCGTGCGTG CGCCGGTGTCCCCAGAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110} {0: 1, 1: 0, 2: 3, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!