ID: 1084519531_1084519536

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084519531 1084519536
Species Human (GRCh38) Human (GRCh38)
Location 11:69655061-69655083 11:69655077-69655099
Sequence CCGGGAGAGCAAAGCACCGTGTC CCGTGTCAGGGCCATGATCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 73} {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!