ID: 1084527010_1084527014

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084527010 1084527014
Species Human (GRCh38) Human (GRCh38)
Location 11:69703986-69704008 11:69704004-69704026
Sequence CCCTAGATCCTGGACGCAGCGCT GCGCTCCTGCTCTGACGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 48} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!