ID: 1084529153_1084529167

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084529153 1084529167
Species Human (GRCh38) Human (GRCh38)
Location 11:69716988-69717010 11:69717035-69717057
Sequence CCCCACCTAGGAAACAGGATGGA AGGGAGCCAGGCCAAGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!