ID: 1084537336_1084537340

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084537336 1084537340
Species Human (GRCh38) Human (GRCh38)
Location 11:69764815-69764837 11:69764833-69764855
Sequence CCCAGTTCTTCTAGCTCGATCCA ATCCAGGACCCCTCCTACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!