ID: 1084539096_1084539108

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1084539096 1084539108
Species Human (GRCh38) Human (GRCh38)
Location 11:69775425-69775447 11:69775468-69775490
Sequence CCTGGGCGCCCGGGGCGCTGTGG CCGCCTGCCAATCAGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 272} {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!