ID: 1084546180_1084546191

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084546180 1084546191
Species Human (GRCh38) Human (GRCh38)
Location 11:69816244-69816266 11:69816291-69816313
Sequence CCCCCGTCCCCTGGCTTGATGTG CGCCCACCCACGTGACAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 1070} {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!