ID: 1084546836_1084546845

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084546836 1084546845
Species Human (GRCh38) Human (GRCh38)
Location 11:69818897-69818919 11:69818944-69818966
Sequence CCAGCAGGCTGAGCAGTAGCAGC CGCCCGCCCCGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 343} {0: 1, 1: 0, 2: 11, 3: 90, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!