ID: 1084563774_1084563787

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1084563774 1084563787
Species Human (GRCh38) Human (GRCh38)
Location 11:69918486-69918508 11:69918516-69918538
Sequence CCTGGGTGCCCTCAGCACGCCCC CCCCGTGAGGACGTCTGCCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!