ID: 1084588828_1084588846

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084588828 1084588846
Species Human (GRCh38) Human (GRCh38)
Location 11:70078735-70078757 11:70078782-70078804
Sequence CCCGGGCGGGAGGGCCGCGCACC GGGCGGCGGCAGGGCCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 191} {0: 1, 1: 0, 2: 2, 3: 53, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!