ID: 1084598642_1084598649

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1084598642 1084598649
Species Human (GRCh38) Human (GRCh38)
Location 11:70132071-70132093 11:70132096-70132118
Sequence CCCTCTGGGGTAAGCAGGGCTCC AGCACTGGGTTTTTGGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 195} {0: 1, 1: 0, 2: 3, 3: 23, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!