ID: 1084603136_1084603148

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084603136 1084603148
Species Human (GRCh38) Human (GRCh38)
Location 11:70158459-70158481 11:70158512-70158534
Sequence CCATCCCCCTCCTGCTGATACAG CCAGTGCCAGCCAGAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 335} {0: 1, 1: 0, 2: 4, 3: 58, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!