ID: 1084603647_1084603652

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084603647 1084603652
Species Human (GRCh38) Human (GRCh38)
Location 11:70160676-70160698 11:70160692-70160714
Sequence CCCTGCACCACCTGAGGATGTCC GATGTCCCTGAGCTCACCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 162} {0: 1, 1: 0, 2: 2, 3: 14, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!