ID: 1084606120_1084606128

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1084606120 1084606128
Species Human (GRCh38) Human (GRCh38)
Location 11:70173050-70173072 11:70173096-70173118
Sequence CCCAGCATCCACTGGTGACCAAA TTCCAAGATAACTTCAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 148} {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!