ID: 1084610862_1084610867

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084610862 1084610867
Species Human (GRCh38) Human (GRCh38)
Location 11:70202281-70202303 11:70202296-70202318
Sequence CCTCCTCACCTCCAGACCCACGG ACCCACGGCATTGCTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 340} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!