ID: 1084628123_1084628127

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084628123 1084628127
Species Human (GRCh38) Human (GRCh38)
Location 11:70324599-70324621 11:70324646-70324668
Sequence CCTGAAATACTTTTCATACCTTT TCAGCATGATCACACATTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 433} {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!