ID: 1084636766_1084636774

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1084636766 1084636774
Species Human (GRCh38) Human (GRCh38)
Location 11:70398320-70398342 11:70398359-70398381
Sequence CCCCGCCGCGGGCTGTGTGCTGC GCGCGCGCAACGCTACTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138} {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!